Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300240 |
Name | oriT_pTn7tluxK3 |
Organism | Promoter capture vector pTn7tluxK3 |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | KC332282 (_) |
oriT length | 262 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 262 nt
>oriT_pTn7tluxK3
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Bruckbauer ST et al. (2015) Tn5/7-lux: a versatile tool for the identification and capture of promoters in gram-negative bacteria. BMC Microbiol. 0.636805556. [PMID:25648327]
Host bacterium
ID | 453 | GenBank | KC332282 |
Plasmid name | Promoter capture vector pTn7tluxK3 | Incompatibility group | - |
Plasmid size | 9661 bp | Coordinate of oriT [Strand] | |
Host baterium | Promoter capture vector pTn7tluxK3 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |