Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300233
Name   oriT_pTn5.7luxG6 in_silico
Organism   Promoter capture vector pTn5.7luxG6
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KC332289 (_)
oriT length   262 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 262 nt

>oriT_pTn5.7luxG6
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Bruckbauer ST et al. (2015) Tn5/7-lux: a versatile tool for the identification and capture of promoters in gram-negative bacteria. BMC Microbiol. 0.636805556. [PMID:25648327]


Host bacterium


ID   446 GenBank   KC332289
Plasmid name   Promoter capture vector pTn5.7luxG6 Incompatibility group   -
Plasmid size   11021 bp Coordinate of oriT [Strand]   
Host baterium   Promoter capture vector pTn5.7luxG6

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -