Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300230
Name   oriT_pRMR6K-Tc experimental
Organism   Cloning vector pRMR6K-Tc
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AB777647 (_)
oriT length   254 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 254 nt

>oriT_pRMR6K-Tc
GGCCGGCCTACGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Miyazaki R et al. (2013) A new large-DNA-fragment delivery system based on integrase activity from an integrative and conjugative element. Appl Environ Microbiol. 79(14):4440-7. [PMID:23686268]


Host bacterium


ID   443 GenBank   AB777647
Plasmid name   Cloning vector pRMR6K-Tc Incompatibility group   -
Plasmid size   6188 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pRMR6K-Tc

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -