Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300225 |
| Name | oriT_pRMTn-Gm |
| Organism | Cloning vector pRMTn-Gm |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB777652 (_) |
| oriT length | 254 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 254 nt
>oriT_pRMTn-Gm
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTAGGCCGGCC
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTAGGCCGGCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Miyazaki R et al. (2013) A new large-DNA-fragment delivery system based on integrase activity from an integrative and conjugative element. Appl Environ Microbiol. 79(14):4440-7. [PMID:23686268]
Host bacterium
| ID | 438 | GenBank | AB777652 |
| Plasmid name | Cloning vector pRMTn-Gm | Incompatibility group | - |
| Plasmid size | 7306 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pRMTn-Gm |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |