Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300214
Name   oriT_pUCP18T-miniTn7-lux-Gm experimental
Organism   Reporter vector pUCP18T-miniTN7-lux-Gm
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KC848884 (_)
oriT length   269 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 269 nt

>oriT_pUCP18T-miniTn7-lux-Gm
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAAGGAATCCCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Damron FH et al. (2013) Construction of mobilizable mini-Tn7 vectors for bioluminescent detection of gram-negative bacteria and single-copy promoter lux reporter analysis. Appl Environ Microbiol. 79(13):4149-53. [PMID:23584769]


Host bacterium


ID   427 GenBank   KC848884
Plasmid name   Reporter vector pUCP18T-miniTn7-lux-Gm Incompatibility group   ColRNAI
Plasmid size   11888 bp Coordinate of oriT [Strand]   
Host baterium   Reporter vector pUCP18T-miniTN7-lux-Gm

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -