Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   300213
Name   oriT_pFE604T in_silico
Organism   Conjugative cloning vector pFE604T
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AB848355 (_)
oriT length   335 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site    		  
Note   _

  oriT sequence  


Download         Length: 335 nt

>oriT_pFE604T
GCCACCTCTGGTGACTTTATCCGTAAATAATTTAACCCACTCCACAAAAAGGCTCAACAGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGTTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCGCGGCC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Yong HT et al. (2013) Development of a system for discovery of genetic interactions for essential genes in Escherichia coli K-12. Genes Genet Syst . 88(4):233-40. [PMID:24463526]


Host bacterium

ID   426 GenBank   AB848355
Plasmid name   Conjugative cloning vector pFE604T DNA Incompatibility group   IncFIA
Plasmid size   10504 bp Coordinate of oriT [Strand]   
Host baterium   Conjugative cloning vector pFE604T

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -