Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300205 |
| Name | oriT_pTn7xluxG0  |
| Organism | Cloning vector pTn7xluxG0 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KF532964 (_) |
| oriT length | 262 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 262 nt
>oriT_pTn7xluxG0
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Bruckbauer ST et al. (2015) Tn5/7-lux: a versatile tool for the identification and capture of promoters in gram-negative bacteria. BMC Microbiol. 0.636805556. [PMID:25648327]
Host bacterium
| ID | 418 | GenBank | KF532964 |
| Plasmid name | Cloning vector pTn7xluxG0 | Incompatibility group | - |
| Plasmid size | 9783 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pTn7xluxG0 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |