Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300201 |
Name | oriT_pUWLab |
Organism | Sequence 142 from Patent WO2013092672 |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | JC018930 (_) |
oriT length | 122 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 122 nt
>oriT_pUWLab
ACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
ACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 414 | GenBank | JC018930 |
Plasmid name | Vector pUWLab | Incompatibility group | ColRNAI |
Plasmid size | 13799 bp | Coordinate of oriT [Strand] | |
Host baterium | Sequence 142 from Patent WO2013092672 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |