Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300200
Name   oriT_pLabAmp in_silico
Organism   Sequence 144 from Patent WO2013092672
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JC018932 (_)
oriT length   122 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 122 nt

>oriT_pLabAmp
ACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   413 GenBank   JC018932
Plasmid name   Vector pLab Amp Incompatibility group   ColRNAI
Plasmid size   15787 bp Coordinate of oriT [Strand]   
Host baterium   Sequence 144 from Patent WO2013092672

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -