Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300199 |
| Name | oriT_pUWLoriT  |
| Organism | Sequence 162 from Patent WO2013092672 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JC018950 (_) |
| oriT length | 122 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 122 nt
>oriT_pUWLoriT
ACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
ACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 412 | GenBank | JC018950 |
| Plasmid name | pUWLoriT plasmid | Incompatibility group | ColRNAI |
| Plasmid size | 7403 bp | Coordinate of oriT [Strand] | |
| Host baterium | Sequence 162 from Patent WO2013092672 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |