Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300193
Name   oriT_pattBCCsHygoriT in_silico
Organism   Cloning vector pattBCCsHygoriT
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KF488568 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 242 nt

>oriT_pattBCCsHygoriT
CGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Myronovskyi M et al. (2014) Iterative marker excision system. Appl Microbiol Biotechnol. 98(10):4557-70. [PMID:24473925]


Host bacterium


ID   406 GenBank   KF488568
Plasmid name   Cloning vector pattBCCsHygoriT Incompatibility group   ColRNAI
Plasmid size   3907 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pattBCCsHygoriT

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -