Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300192
Name   oriT_pattPGGsaacoriT in_silico
Organism   Cloning vector pattPGGsaacoriT
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KF488569 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 242 nt

>oriT_pattPGGsaacoriT
CGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Myronovskyi M et al. (2014) Iterative marker excision system. Appl Microbiol Biotechnol. 98(10):4557-70. [PMID:24473925]


Host bacterium


ID   405 GenBank   KF488569
Plasmid name   Cloning vector pattPGGsaacoriT Incompatibility group   ColRNAI
Plasmid size   3670 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pattPGGsaacoriT

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -