Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300191 |
| Name | oriT_pV2  |
| Organism | Cloning vector pV2 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KJ569568 (2971..3196 [-], 226 nt) |
| oriT length | 226 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 226 nt
>oriT_pV2
ATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATG
ATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hertel R et al. (2015) Conjugative reporter system for the use in Bacillus licheniformis and closely related Bacilli. Lett Appl Microbiol. 60(2):162-7. [PMID:25363901]
Host bacterium
| ID | 404 | GenBank | KJ569568 |
| Plasmid name | Cloning vector pV2 | Incompatibility group | ColRNAI |
| Plasmid size | 4423 bp | Coordinate of oriT [Strand] | 2971..3196 [-] |
| Host baterium | Cloning vector pV2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |