Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300190 |
| Name | oriT_pV3SDlacZ  |
| Organism | Cloning vector pV3SDlacZ |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KJ569569 (6134..6359 [-], 226 nt) |
| oriT length | 226 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 226 nt
>oriT_pV3SDlacZ
ATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATG
ATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hertel R et al. (2015) Conjugative reporter system for the use in Bacillus licheniformis and closely related Bacilli. Lett Appl Microbiol. 60(2):162-7. [PMID:25363901]
Host bacterium
| ID | 403 | GenBank | KJ569569 |
| Plasmid name | Cloning vector pV3SDlacZ | Incompatibility group | ColRNAI |
| Plasmid size | 7586 bp | Coordinate of oriT [Strand] | 6134..6359 [-] |
| Host baterium | Cloning vector pV3SDlacZ |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |