Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300186
Name   oriT_pSEVA12DKR-J experimental
Organism   Synthetic construct clone pSEVA12DKR-J
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KJ686606 (_)
oriT length   236 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 236 nt

>oriT_pSEVA12DKR-J
GCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Wright O et al. (2015) GeneGuard: a Modular Plasmid System Designed for Biosafety. ACS Synth Biol. 4(3):307-16. [PMID:24847673]


Host bacterium


ID   399 GenBank   KJ686606
Plasmid name   Synthetic construct clone pSEVA12DKR-J Incompatibility group   IncX2
Plasmid size   8156 bp Coordinate of oriT [Strand]   
Host baterium   Synthetic construct clone pSEVA12DKR-J

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -