Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300182
Name   oriT_pSEVA3b61 experimental
Organism   Synthetic construct clone pSEVA3b61
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KJ686616 (_)
oriT length   236 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 236 nt

>oriT_pSEVA3b61
GCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Wright O et al. (2015) GeneGuard: a Modular Plasmid System Designed for Biosafety. ACS Synth Biol. 4(3):307-16. [PMID:24847673]


Host bacterium


ID   395 GenBank   KJ686616
Plasmid name   Synthetic construct clone pSEVA3b61 Incompatibility group   -
Plasmid size   3849 bp Coordinate of oriT [Strand]   
Host baterium   Synthetic construct clone pSEVA3b61

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -