Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300179
Name   oriT_pBD62 experimental
Organism   Integrative expression vector pBD62
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KJ720574 (_)
oriT length   257 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 257 nt

>oriT_pBD62
GGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Das B et al. (2014) A Novel, Broad-Range, CTX桅-Derived Stable Integrative Expression Vector for Functional Studies. J Bacteriol. 196(23):4071-80. [PMID:25225263]


Host bacterium


ID   392 GenBank   KJ720574
Plasmid name   Integrative expression vector pBD62 Incompatibility group   -
Plasmid size   3226 bp Coordinate of oriT [Strand]   
Host baterium   Integrative expression vector pBD62

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -