Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300178
Name   oriT_pCPP5301 in_silico
Organism   Cloning vector pCPP5301
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU024541 (_)
oriT length   110 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 110 nt

>oriT_pCPP5301
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kvitko BH et al. (2007) Identification of harpins in Pseudomonas syringae pv. tomato DC3000, which are functionally similar to HrpK1 in promoting translocation of type III secretion system effectors. J Bacteriol. 189(22):8059-72. [PMID:17873033]


Host bacterium


ID   391 GenBank   EU024541
Plasmid name   Cloning vector pCPP5301 Incompatibility group   IncP1
Plasmid size   15487 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pCPP5301

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -