Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300178 |
Name | oriT_pCPP5301 |
Organism | Cloning vector pCPP5301 |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | EU024541 (_) |
oriT length | 110 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pCPP5301
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Kvitko BH et al. (2007) Identification of harpins in Pseudomonas syringae pv. tomato DC3000, which are functionally similar to HrpK1 in promoting translocation of type III secretion system effectors. J Bacteriol. 189(22):8059-72. [PMID:17873033]
Host bacterium
ID | 391 | GenBank | EU024541 |
Plasmid name | Cloning vector pCPP5301 | Incompatibility group | IncP1 |
Plasmid size | 15487 bp | Coordinate of oriT [Strand] | |
Host baterium | Cloning vector pCPP5301 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |