Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300175 |
| Name | oriT_pCPP5386 |
| Organism | Cloning vector pCPP5386 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | EU024544 (_) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pCPP5386
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Kvitko BH et al. (2007) Identification of harpins in Pseudomonas syringae pv. tomato DC3000, which are functionally similar to HrpK1 in promoting translocation of type III secretion system effectors. J Bacteriol. 189(22):8059-72. [PMID:17873033]
Host bacterium
| ID | 388 | GenBank | EU024544 |
| Plasmid name | Cloning vector pCPP5386 | Incompatibility group | IncP1 |
| Plasmid size | 11865 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pCPP5386 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |