Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300174 |
| Name | oriT_pUCP20T |
| Organism | Cloning vector pUCP20T |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | U33750 (_) |
| oriT length | 268 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 268 nt
>oriT_pUCP20T
GGGATTCCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
GGGATTCCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] West SE et al. (1994) Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene. 148(1):81-6. [PMID:7926843]
Host bacterium
| ID | 387 | GenBank | U33750 |
| Plasmid name | Cloning vector pUCP20T | Incompatibility group | ColRNAI |
| Plasmid size | 4174 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pUCP20T |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |