Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300171
Name   oriT_pA1.GFP.A2 in_silico
Organism   AAVS1 targeting vector pA1.GFP.A2
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   GQ380658 (_)
oriT length   296 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   _

  oriT sequence  


Download         Length: 296 nt

>oriT_pA1.GFP.A2
CGCACCGCTAGCAGCGCCCCTAGCGGTATCCTATAAAAAAACACACCGCGCCGCTAGCAGCACCCCTAATATAAAATAATGTTTTTTATAAAAATAGTCAGTACCACCCCTACAAAACGGTGTCGGCGCGTTGTTGTAGCCGCGCCGACACCGCTTTTTTAAATATCATAAAGAGAGTAAGAGAAACTAATTTTTCATAACACTCTATTTATAAAGAAAAATCAGCAAAAACTTGTTTTTGCGTGGGGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTTGAGCCTTTTTGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] van Nierop GP et al. (2009) Stimulation of homology-directed gene targeting at an endogenous human locus by a nicking endonuclease. Nucleic Acids Res. 37(17):5725-36. [PMID:19651880]


Host bacterium


ID   384 GenBank   GQ380658
Plasmid name   AAVS1 targeting vector pA1.GFP.A2 Incompatibility group   -
Plasmid size   12653 bp Coordinate of oriT [Strand]   
Host baterium   AAVS1 targeting vector pA1.GFP.A2

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -