Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300165 |
| Name | oriT_pFLP2  |
| Organism | Site-specific excision vector pFLP2 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AF048702 (_) |
| oriT length | 257 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 257 nt
>oriT_pFLP2
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGAT
CCTTAAGGTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGAT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hoang TT et al. (1998) A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 212(1):77-86. [PMID:9661666]
Host bacterium
| ID | 378 | GenBank | AF048702 |
| Plasmid name | Site-specific excision vector pFLP2 | Incompatibility group | ColRNAI |
| Plasmid size | 9297 bp | Coordinate of oriT [Strand] | |
| Host baterium | Site-specific excision vector pFLP2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |