Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300163 |
| Name | oriT_pRK415  |
| Organism | Broad host range expression vector pRK415 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | EF437940 (_) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pRK415
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hülter N et al. (2008) Double illegitimate recombination events integrate DNA segments through two different mechanisms during natural transformation of Acinetobacter baylyi. Mol Microbiol. 67(5):984-95. [PMID:18194157]
Host bacterium
| ID | 376 | GenBank | EF437940 |
| Plasmid name | Broad host range expression vector pRK415 | Incompatibility group | IncP1 |
| Plasmid size | 10690 bp | Coordinate of oriT [Strand] | |
| Host baterium | Broad host range expression vector pRK415 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |