Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300162
Name   oriT_pK18msr24A experimental
Organism   Ti-curing vector pK18msr24A
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AB693967 (_)
oriT length   70 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 70 nt

>oriT_pK18msr24A
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGAC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Schäfer A et al. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 145(1):69-73. [PMID:8045426]


Host bacterium


ID   375 GenBank   AB693967
Plasmid name   Ti-curing vector pK18msr24A DNA Incompatibility group   ColRNAI
Plasmid size   12861 bp Coordinate of oriT [Strand]   
Host baterium   Ti-curing vector pK18msr24A

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -