Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300161 |
| Name | oriT_pK18msr  |
| Organism | Cloning vector pK18msr |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB694752 (_) |
| oriT length | 70 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 70 nt
>oriT_pK18msr
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGAC
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGAC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Schäfer A et al. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 145(1):69-73. [PMID:8045426]
Host bacterium
| ID | 374 | GenBank | AB694752 |
| Plasmid name | Cloning vector pK18msr DNA | Incompatibility group | ColRNAI |
| Plasmid size | 10621 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pK18msr |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |