Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300160 |
| Name | oriT_pAK405  |
| Organism | Cloning vector pAK405 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JQ432562 (_) |
| oriT length | 99 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 99 nt
>oriT_pAK405
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACA
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Kaczmarczyk A et al. (2012) Markerless gene deletion system for sphingomonads. Appl Environ Microbiol. 78(10):3774-7. [PMID:22427496]
Host bacterium
| ID | 373 | GenBank | JQ432562 |
| Plasmid name | Cloning vector pAK405 | Incompatibility group | ColRNAI |
| Plasmid size | 3937 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pAK405 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |