Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300156 |
| Name | oriT_pK18mobsacB  |
| Organism | Cloning vector pK18mobsacB |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | FJ437239 (_) |
| oriT length | 70 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 70 nt
>oriT_pK18mobsacB
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGAC
GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGAC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Kvitko BH et al. (2011) Construction of Pseudomonas syringae pv. tomato DC3000 mutant and polymutant strains. Methods Mol Biol. 712:109-28. [PMID:21359804]
Host bacterium
| ID | 369 | GenBank | FJ437239 |
| Plasmid name | Cloning vector pK18mobsacB | Incompatibility group | ColRNAI |
| Plasmid size | 5719 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pK18mobsacB |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |