Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300154 |
| Name | oriT_pRH210  |
| Organism | Helper |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB526839 (_) |
| oriT length | 202 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 202 nt
>oriT_pRH210
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAA
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Figurski DH et al. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A. 76(4):1648-52. [PMID:377280]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 7174..17601
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Locus_1 | 4870..6018 | - | 1149 | BAI47855 | TrfA | - |
| Locus_2 | 6067..6417 | - | 351 | BAI47856 | single strand DNA binding protein | - |
| Locus_3 | 6538..6903 | + | 366 | BAI47857 | TrbA | - |
| Locus_4 | 7174..8133 | + | 960 | BAI47858 | TrbB | virB11 |
| Locus_5 | 8146..8583 | + | 438 | BAI47859 | TrbC | virB2 |
| Locus_6 | 8586..8897 | + | 312 | BAI47860 | TrbD | virB3 |
| Locus_7 | 8894..11452 | + | 2559 | BAI47861 | TrbE | virb4 |
| Locus_8 | 11449..12207 | + | 759 | BAI47862 | TrbF | virB8 |
| Locus_9 | 12219..13112 | + | 894 | BAI47863 | TrbG | virB9 |
| Locus_10 | 13116..13598 | + | 483 | BAI47864 | TrbH | - |
| Locus_11 | 13603..14994 | + | 1392 | BAI47865 | TrbI | virB10 |
| Locus_12 | 15011..15787 | + | 777 | BAI47866 | TrbJ | virB5 |
| Locus_13 | 15799..16008 | + | 210 | BAI47867 | TrbK | - |
| Locus_14 | 16015..17601 | + | 1587 | BAI47868 | TrbL | virB6 |
| Locus_15 | 17625..18224 | + | 600 | BAI47869 | TrbM | - |
| Locus_16 | 18240..18944 | + | 705 | BAI47870 | TrbN | - |
| Locus_17 | 18975..19238 | + | 264 | BAI47871 | TrbO | - |
| Locus_18 | 20309..20833 | - | 525 | BAI47872 | repressor protein CI | - |
| Locus_19 | 21616..21906 | - | 291 | BAI47873 | TraA | - |
| Locus_20 | 21914..22354 | - | 441 | BAI47874 | TraB | - |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |