Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300153 |
| Name | oriT_pRH220  |
| Organism | Helper |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB526840 (_) |
| oriT length | 202 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 202 nt
>oriT_pRH220
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAA
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Figurski DH et al. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A. 76(4):1648-52. [PMID:377280]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 7980..18407
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Locus_2 | 5676..6824 | - | 1149 | BAI47898 | TrfA | - |
| Locus_3 | 6873..7223 | - | 351 | BAI47899 | single strand DNA binding protein | - |
| Locus_4 | 7344..7709 | + | 366 | BAI47900 | TrbA | - |
| Locus_5 | 7980..8939 | + | 960 | BAI47901 | TrbB | virB11 |
| Locus_6 | 8952..9389 | + | 438 | BAI47902 | TrbC | virB2 |
| Locus_7 | 9392..9703 | + | 312 | BAI47903 | TrbD | virB3 |
| Locus_8 | 9700..12258 | + | 2559 | BAI47904 | TrbE | virb4 |
| Locus_9 | 12255..13013 | + | 759 | BAI47905 | TrbF | virB8 |
| Locus_10 | 13025..13918 | + | 894 | BAI47906 | TrbG | virB9 |
| Locus_11 | 13922..14404 | + | 483 | BAI47907 | TrbH | - |
| Locus_12 | 14409..15800 | + | 1392 | BAI47908 | TrbI | virB10 |
| Locus_13 | 15817..16593 | + | 777 | BAI47909 | TrbJ | virB5 |
| Locus_14 | 16605..16814 | + | 210 | BAI47910 | TrbK | - |
| Locus_15 | 16821..18407 | + | 1587 | BAI47911 | TrbL | virB6 |
| Locus_16 | 18431..19030 | + | 600 | BAI47912 | TrbM | - |
| Locus_17 | 19046..19750 | + | 705 | BAI47913 | TrbN | - |
| Locus_18 | 19781..20044 | + | 264 | BAI47914 | TrbO | - |
| Locus_19 | 21115..21639 | - | 525 | BAI47915 | repressor protein CI | - |
| Locus_20 | 22422..22712 | - | 291 | BAI47916 | TraA | - |
| Locus_21 | 22720..23160 | - | 441 | BAI47917 | TraB | - |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |