Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300152
Name   oriT_patt-saac-oriT in_silico
Organism   Cloning vector patt-saac-oriT
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   KF488571 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 242 nt

>oriT_patt-saac-oriT
CGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Myronovskyi M et al. (2014) Iterative marker excision system. Appl Microbiol Biotechnol. 98(10):4557-70. [PMID:24473925]


Host bacterium


ID   365 GenBank   KF488571
Plasmid name   Cloning vector patt-saac-oriT Incompatibility group   ColRNAI
Plasmid size   3667 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector patt-saac-oriT

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -