Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300149 |
| Name | oriT_pKM24KH |
| Organism | Binary vector pKM24KH |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | HM036220 (9300..9409 [-], 110 nt) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4/RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pKM24KH
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 362 | GenBank | HM036220 |
| Plasmid name | Binary vector pKM24KH | Incompatibility group | IncP1 |
| Plasmid size | 12945 bp | Coordinate of oriT [Strand] | 9300..9409 [-] |
| Host baterium | Binary vector pKM24KH |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |