Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300147 |
| Name | oriT_pMCI002  |
| Organism | Cloning vector pMCI002 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JN788332 (2832..2943 [-], 112 nt) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 112 nt
>oriT_pMCI002
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Uhlich GA et al. (2012) A cloning vector for creation of Escherichia coli lacZ translational fusions and generation of linear template for chromosomal integration. Plasmid. 67(3):259-63. [PMID:22197962]
Host bacterium
| ID | 360 | GenBank | JN788332 |
| Plasmid name | Cloning vector pMCI002 | Incompatibility group | - |
| Plasmid size | 3990 bp | Coordinate of oriT [Strand] | 2832..2943 [-] |
| Host baterium | Cloning vector pMCI002 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |