Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300146 |
| Name | oriT_pBBRSac3  |
| Organism | Counter-selectable BBR exclusion vector pBBRSac3 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JX514367 (_) |
| oriT length | 34 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | _ |
oriT sequence
Download Length: 34 nt
>oriT_pBBRSac3
TACTCACTAGACTTTGCTTCGCAAAGTCGTGACC
TACTCACTAGACTTTGCTTCGCAAAGTCGTGACC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 359 | GenBank | JX514367 |
| Plasmid name | Counter-selectable BBR exclusion vector pBBRSac3 | Incompatibility group | - |
| Plasmid size | 7265 bp | Coordinate of oriT [Strand] | |
| Host baterium | Counter-selectable BBR exclusion vector pBBRSac3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |