Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300143
Name   oriT_pFTCAPL-GW experimental
Organism   Cloning vector pFTCAPL-GW
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JX573201 (_)
oriT length   279 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 279 nt

>oriT_pFTCAPL-GW
GTATACTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGATAAGCTTGGCGTAATCATGGTCATCATATG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   356 GenBank   JX573201
Plasmid name   Cloning vector pFTCAPL-GW Incompatibility group   IncFIA
Plasmid size   11445 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pFTCAPL-GW

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -