Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   300140
Name   oriT_PGERM experimental
Organism   PGERM
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EF155418 (_)
oriT length   112 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site    		  
Note   oriT_RK2

  oriT sequence  


Download         Length: 112 nt

>oriT_PGERM
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Shoemaker NB et al. (2000) Multiple gene products and sequences required for excision of the mobilizable integrated Bacteroides element NBU1. J Bacteriol. 182(4):928-36. [PMID:10648516]


Host bacterium

ID   353 GenBank   EF155418
Plasmid name   PGERM gene disruption vector Incompatibility group   ColRNAI
Plasmid size   4807 bp Coordinate of oriT [Strand]   
Host baterium   PGERM

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -