Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300139
Name   oriT_pJIR1457 experimental
Organism   Shuttle vector pJIR1457
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   U90555 (_)
oriT length   244 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 244 nt

>oriT_pJIR1457
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Lyras D et al. (1998) Conjugative transfer of RP4-oriT shuttle vectors from Escherichia coli to Clostridium perfringens. Plasmid. . 39(2):160-4. [PMID:9514706]


Host bacterium


ID   352 GenBank   U90555
Plasmid name   Shuttle vector pJIR1457 Incompatibility group   ColRNAI
Plasmid size   6243 bp Coordinate of oriT [Strand]   
Host baterium   Shuttle vector pJIR1457

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -