Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300138
Name   oriT_pAA56 experimental
Organism   Cloning vector pAA56
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JF934877 (_)
oriT length   112 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 112 nt

>oriT_pAA56
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Xu K et al. (2012) Production of recombineering substrates with standard-size PCR primers. FEMS Microbiol Lett. 337(2):97-103. [PMID:23003673]


Host bacterium


ID   351 GenBank   JF934877
Plasmid name   Cloning vector pAA56 Incompatibility group   ColRNAI
Plasmid size   3420 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pAA56

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -