Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300138 |
| Name | oriT_pAA56  |
| Organism | Cloning vector pAA56 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JF934877 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 112 nt
>oriT_pAA56
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Xu K et al. (2012) Production of recombineering substrates with standard-size PCR primers. FEMS Microbiol Lett. 337(2):97-103. [PMID:23003673]
Host bacterium
| ID | 351 | GenBank | JF934877 |
| Plasmid name | Cloning vector pAA56 | Incompatibility group | ColRNAI |
| Plasmid size | 3420 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pAA56 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |