Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300137 |
| Name | oriT_pJIR1456  |
| Organism | Shuttle vector pJIR1456 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | U90554 (_) |
| oriT length | 224 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 224 nt
>oriT_pJIR1456
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Lyras D et al. (1998) Conjugative transfer of RP4-oriT shuttle vectors from Escherichia coli to Clostridium perfringens. Plasmid. . 39(2):160-4. [PMID:9514706]
Host bacterium
| ID | 350 | GenBank | U90554 |
| Plasmid name | Shuttle vector pJIR1456 | Incompatibility group | ColRNAI |
| Plasmid size | 6857 bp | Coordinate of oriT [Strand] | |
| Host baterium | Shuttle vector pJIR1456 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |