Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300136 |
| Name | oriT_pMMB66EH  |
| Organism | Plasmid DEFINITION |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | X15234 (_) |
| oriT length | 88 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RSF1010 |
oriT sequence
Download Length: 88 nt
>oriT_pMMB66EH
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Fürste JP et al. (1986) Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene. 48(1):119-31. [PMID:3549457]
Host bacterium
| ID | 349 | GenBank | X15234 |
| Plasmid name | Plasmid pMMB66EH expression vector | Incompatibility group | IncQ1 |
| Plasmid size | 8807 bp | Coordinate of oriT [Strand] | |
| Host baterium | Plasmid DEFINITION |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |