Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300133
Name   oriT_pMR10 experimental
Organism   Cloning vector pMR10
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AJ606312 (_)
oriT length   329 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 329 nt

>oriT_pMR10
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATGAGGGCAAGCGGATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCAAGGTGT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   346 GenBank   AJ606312
Plasmid name   Cloning vector pMR10 Incompatibility group   IncP1
Plasmid size   8798 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pMR10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -