Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300129 |
| Name | oriT_pRK442(H)  |
| Organism | Cloning vector pRK442(H) |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY204478 (_) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pRK442(H)
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Scott HN et al. (2003) Sequences of versatile broad-host-range vectors of the RK2 family. Plasmid. 50(1):74-9. [PMID:12826060]
Host bacterium
| ID | 342 | GenBank | AY204478 |
| Plasmid name | Cloning vector pRK442(H) | Incompatibility group | IncP1 |
| Plasmid size | 9820 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pRK442(H) |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |