Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300124 |
| Name | oriT_pRK7813  |
| Organism | Cloning vector pRK7813 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KC442292 (_) |
| oriT length | 111 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pRK7813
GCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
GCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Cheng J et al. (2014) Versatile broad-host-range cosmids for construction of high quality metagenomic libraries. J Microbiol Methods. 99:27-34. [PMID:24495694]
Host bacterium
| ID | 337 | GenBank | KC442292 |
| Plasmid name | Cloning vector pRK7813 | Incompatibility group | IncP1 |
| Plasmid size | 11797 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pRK7813 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |