Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300123 |
| Name | oriT_pJC8  |
| Organism | Cloning vector pJC8 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | KC149513 (_) |
| oriT length | 110 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 110 nt
>oriT_pJC8
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 336 | GenBank | KC149513 |
| Plasmid name | Cloning vector pJC8 | Incompatibility group | IncP1 |
| Plasmid size | 13053 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pJC8 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |