Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300110 |
| Name | oriT_pKS800  |
| Organism | Cloning vector pKS800 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB521037 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 112 nt
>oriT_pKS800
GCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCG
GCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Hattori Y et al. (2002) Ordered cosmid library of the Mesorhizobium loti MAFF303099 genome for systematic gene disruption and complementation analysis. Plant Cell Physiol. 43(12):1542-57. [PMID:12514252]
Host bacterium
| ID | 323 | GenBank | AB521037 |
| Plasmid name | Cloning vector pKS800 | Incompatibility group | IncP1 |
| Plasmid size | 20392 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pKS800 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |