Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300107 |
Name | oriT_pMQ70 |
Organism | Shuttle vector pMQ70 |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | DQ642035 (_) |
oriT length | 260 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | _ |
oriT sequence
Download Length: 260 nt
>oriT_pMQ70
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Shanks RM et al. (2006) Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl Environ Microbiol. 72(7):5027-36. [PMID:16820502]
Host bacterium
ID | 320 | GenBank | DQ642035 |
Plasmid name | Shuttle vector pMQ70 | Incompatibility group | ColRNAI |
Plasmid size | 7338 bp | Coordinate of oriT [Strand] | |
Host baterium | Shuttle vector pMQ70 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |