Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300106
Name   oriT_pMQ72 in_silico
Organism   Shuttle vector pMQ72
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   DQ642037 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4/RK2

  oriT sequence  


Download         Length: 260 nt

>oriT_pMQ72
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Shanks RM et al. (2006) Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl Environ Microbiol. 72(7):5027-36. [PMID:16820502]


Host bacterium


ID   319 GenBank   DQ642037
Plasmid name   Shuttle vector pMQ72 Incompatibility group   ColRNAI
Plasmid size   8039 bp Coordinate of oriT [Strand]   
Host baterium   Shuttle vector pMQ72

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -