Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300088 |
| Name | oriT_pME6032  |
| Organism | Shuttle vector pME6032 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ645594 (_) |
| oriT length | 22 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_p15A |
oriT sequence
Download Length: 22 nt
>oriT_pME6032
TAAGCCAGTATACACTCCGCTA
TAAGCCAGTATACACTCCGCTA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Heeb S et al. (2000) Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Mol Plant Microbe Interact. 13(2):232-7. [PMID:10659714]
Host bacterium
| ID | 301 | GenBank | DQ645594 |
| Plasmid name | Shuttle vector pME6032 | Incompatibility group | Col440I |
| Plasmid size | 9755 bp | Coordinate of oriT [Strand] | |
| Host baterium | Shuttle vector pME6032 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |