Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   300087
Name   oriT_pCOMT-Kan experimental
Organism   Shuttle vector pCOMT-Kan
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AY303238 (_)
oriT length   442 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site    		  
Note   oriT_pRS01

  oriT sequence  


Download         Length: 442 nt

>oriT_pCOMT-Kan
CTAGAATGACATCTAGGACAAACTTCCGTAGTCGTTTCCACATCTGGTTTCTTTTTTTTAACATTGTAAACAAGCTCATTGCGCCCCTCCTTCAACCTAATACAATTATAACAGAAAAAGCAAACATCCCTGACAGGCAGGAGGTCATTCCATTACCCCCTACACCCCCTTTGGGAGGAAGAGCCTATCCCTTCCTTGACCTTTTGCAAGCATAGTAAGATGATAGCATCTTACGGAATTTAAGAAATGGATAAGGTTTCTTCCTTATCCATTTACTTAATTTTTGGGGGTGTCCCCAATCCCCATTTTTTATGAAAAGTAGTTTCTACTTCGCATTTTTTCTTTTTCCTTGTAACCAAGAAAAATCAGCCAACATACTTTTGGCTTTTTGTTCTTTGCCCTCTCGTTTTTCGAGGTCATCTGAAGAAGTTGTTTGAATCTC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Staddon JH et al. (2004) Conserved target for group II intron insertion in relaxase genes of conjugative elements of gram-positive bacteria. J Bacteriol. 186(8):2393-401. [PMID:15060042]


Host bacterium

ID   300 GenBank   AY303238
Plasmid name   Shuttle vector pCOMT-Kan Incompatibility group   ColRNAI
Plasmid size   14903 bp Coordinate of oriT [Strand]   
Host baterium   Shuttle vector pCOMT-Kan

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -