Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300082 |
| Name | oriT_pAY201  |
| Organism | Shuttle vector pAY201 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AB526842 (_) |
| oriT length | 88 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RSF1010 |
oriT sequence
Download Length: 88 nt
>oriT_pAY201
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
GTAGGCTATCATGGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Scholz P et al. (1989) Complete nucleotide sequence and gene organization of the broad-host-range plasmid RSF1010. Gene. 75(2):271-88. [PMID:2653965]
Host bacterium
| ID | 295 | GenBank | AB526842 |
| Plasmid name | Shuttle vector pAY201 | Incompatibility group | IncQ1 |
| Plasmid size | 12408 bp | Coordinate of oriT [Strand] | |
| Host baterium | Shuttle vector pAY201 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |