Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300079
Name   oriT_pGID052 experimental
Organism   Cloning vector pGID052
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AJ628448 (_)
oriT length   49 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_pIP501

  oriT sequence  


Download         Length: 49 nt

>oriT_pGID052
TACTAAGGGCGCACTTATACGCAGTAACTTCGTTACTTCGTATTTATCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Beltramo C et al. (2004) A new vector, pGID052, for genetic transfer in Oenococcus oeni. FEMS Microbiol Lett. 236(1):53-60. [PMID:15212790]


Host bacterium


ID   292 GenBank   AJ628448
Plasmid name   Cloning vector pGID052 Incompatibility group   -
Plasmid size   5659 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pGID052

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -