Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300079 |
| Name | oriT_pGID052  |
| Organism | Cloning vector pGID052 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AJ628448 (_) |
| oriT length | 49 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_pIP501 |
oriT sequence
Download Length: 49 nt
>oriT_pGID052
TACTAAGGGCGCACTTATACGCAGTAACTTCGTTACTTCGTATTTATCC
TACTAAGGGCGCACTTATACGCAGTAACTTCGTTACTTCGTATTTATCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Beltramo C et al. (2004) A new vector, pGID052, for genetic transfer in Oenococcus oeni. FEMS Microbiol Lett. 236(1):53-60. [PMID:15212790]
Host bacterium
| ID | 292 | GenBank | AJ628448 |
| Plasmid name | Cloning vector pGID052 | Incompatibility group | - |
| Plasmid size | 5659 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pGID052 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |